Cây sinh dòng virus lở mồm long móng serotype a

  • 31 trang
  • file .pdf
TRƯỜNG ĐẠI HỌC NÔNG LÂM THÀNH PHỐ HỒ CHÍ MINH
BỘ MÔN CÔNG NGHỆ SINH HỌC
Tiểu luận:
Sinh viên thực hiện : Lê Hoàng Lâm GVHD : PGS.TS Nguyễn Ngọc Hải
MSSV : 06126069
PHẦN I: ĐẶT VẤN ĐỀ
Nước ta là một nước có nền nông nghiệp phát triển. Trong đó ngành chăn nuôi
đóng một vài trò quan trọng trong cơ cấu kinh tế của nền nông nghiệp. Giai đoạn 2001-
2006, ngành chăn nuôi có mức tăng trưởng bình quân 7-8%/năm; năm 2007 chỉ đạt 4,6%
và năm 2008 đạt 6%.Theo số liệu thống kê 01.10.2008, Việt Nam có gần 2,90 triệu con
trâu; 6,34 triệu con bò; 26,701 triệu con lợn; 247,320 triệu con gia cầm; 1,48 triệu con dê,
cừu; 121 ngàn con ngựa. Tỷ trọng ngành chăn nuôi trong Nông nghiệp đạt 20-
24,5% giai đoạn 2001-2006, năm 2007 đạt 24,4% và năm 2008 đạt 27%. Bên cạnh đó
do vị trí địa lí , Việt Nam nằm trong vùng khí hậu nhiệt đới, độ ẩm cao là điều kiện thuận
lợi cho một số dịch bệnh phát triển.
Trong số một số bệnh thường gặp, chúng tôi đặc biệt chú ý đến bệnh lở mồm long
móng. Đây là một bệnh thường xảy ra trên đàn vât nuôi gây thiệt hại to lớn đối với nền
kinh tế nước ta.
Trâu bò bị bệnh lở mồm long móng thì phải nghỉ cày kéo, ảnh hưởng đến thời vụ
gieo trồng. Khi khỏi bệnh phải nghỉ hàng tháng mới lấy lại sức.Những con bị long móng
phải đi khập khễnh 2- 3 tháng, có khi thành tật, phải giết thịt.Do bệnh tích của bệnh lở
mồm long móng thể hiện ở miệng, ở vùng móng và ở vùng vú .Khi gia súc bị bệnh thì
núm vú, bầu vú bị sưng, da xung quanh có mụn đỏ và đau, 2- 6 ngày mụn vỡ tạo thành
vết loét dễ gây viêm vú nhiễm trùng.
Bệnh do virus thuộc giống Aphthovirus, họ Picornaviridae có 7 type virus gây
bệnh lở mồm long móng: O, A, C, S.A.T–1, S.A.T- 2, S.A.T- 3 và ASIA-1và hơn 60
subtype. Hiện nay ở nước ta có 2 type gây bệnh là A, O. Đây là bệnh truyền nhiễm cấp
tính lây lan rất nhanh và rất mạnh, rộng cho nhiều loài gia súc, loài nhai lại, heo và
người.Các type virus lở mồm long móng phân bố không đều trên thế giới: các type SAT
thường ở khu vực châu Phi, type O và A ở khu vực Châu Á,Viễn Đông, Nam Mỹ. Type
C ít hơn chỉ có ở khu vực Ấn Độ và Type Asia1 chỉ có ở khu vực Nam Á. Các chủng
virus lở mồm long móng biến đổi rất nhiều và do sự phân bố rộng, phức tạp của chúng
nên thường gặp nhiều khó khăn trong việc xác định nguồn gốc lây lan của chúng.
Vì vậy, để kiểm soát dịch bệnh lở mồm long móng, tránh việc lây lan bệnh trên
diện rộng thì nhất thiết phải sử dụng những loại vacxin thích hợp cho đàn vật nuôi.
Chính bởi vì lí do trên, nên chúng tôi thực hiện tiểu luận “ Cây sinh dòng virus lở mồm
long móng SEROTYPE A”. Mục đích của tiểu luận giúp chúng ta có cái nhìn tổng thể về
virus lở mồm long móng serotype A, giúp các nhà quản lí có kế hoạch phòng chống dịch
bệnh một cách hiệu quả ngay từ khi mới bùng phát.
PHẦN II:TỔNG QUAN
2.1.Bệnh lở mồm long móng
2.1.1. Nguyên nhân:
Do virus thuộc giống Aphthovirus, họ Picornaviridae có 7 type virus gây bệnh lở
mồm long móng: O, A, C, S.A.T–1, S.A.T- 2, S.A.T- 3 và ASIA-1. Hiện nay ở nước ta
có 2 type gây bệnh là A, O và Asia-1.
2.1.2 Sức đề kháng của virus
- Virus có sức đề kháng mạnh. Ở 600C tồn tại 5-15 phút, ở 1000C virus sẽ chết,
từ 0-40C tồn tại 425 ngày, trong đất ẩm virus sống hàng năm, trong thịt ướp lạnh virus
tồn tại khá lâu trong phân virus tồn tại 7 ngày, nước tiểu virus tồn tại 39 ngày.
- Virus dễ bị tiêu diệt bởi các loại thuốc sát trùng của công ty ANOVA như: NOVA-
MC.A30, NOVACIDE, NOVADINE, NOVASEPT, NOVAKON và các loại khác như:
NaOH 1% diệt virus từ 1-10 phút, formol 2%, nước vôi từ 5-10%.
2.1.3. hương thức truyền lây
- Bệnh lây qua đường tiêu hóa, đường hô hấp và sinh dục là đường xâm nhập phụ.
Sự truyền bệnh trực tiếp do nuôi nhốt chung, chăn thả chung… hoặc lây gián tiếp qua
thức ăn, nước uống, dụng cụ chăn nuôi mang mầm bệnh, người, phương tiện vận chuyển.
- Loài mắc bệnh: Trâu bò mắc bệnh nhiều nhất, rồi đến các loài sau: heo, dê cừu, thú
hoang dã… Bệnh có thể lây qua cho người, các loài một móng, ngựa, gia cầm không mắc
bệnh này.
2.1.4. ệu chứng
Thời gian nung bệnh từ 2-7 ngày, trung bình là 3-4 ngày, gồm 3 thể bệnh
2.1.4.1. Thể thông thường
- Bệnh hay gặp ở vùng nhiệt đới, thú ủ rũ, lông dựng, da mũi khô, thú sốt cao 40-
41 0C kéo dài 3 ngày.
- Xuất hiện các mụn nước ở da, vành móng kẻ chân, lưỡi, vú làm thú kém ăn,
nhai khó khăn.
2
- Ở miệng: lưỡi có mụn to ở đầu lưỡi gốc lưỡi ở hai bên lưỡi, xoang trong miệng
trong má, lỗ chân răng, môi có mụn lấm tấm bằng hạt ké, hạt bắp. Sau đó mụn vỡ và tạo
thành các vết loét đáy nhỏ và phủ màu xám. Nước dãi chảy nhiều như bọt xà phòng.
- Ở mũi: niêm mạc có mụn nước, đặt biệt là vành mũi có mụn loét, nước mũi lúc
đầu trong sau đục dần.
- Ở chân, kẽ móng có mụn nước từ trước ra sau, mụn vỡ làm long móng.
- Ngoài da : xuất hiện các mụn loét ở vùng da mỏng như bụng, bẹn, vú, ở đầu
núm vú … Thú giảm sản lượng sữa, sau sữa đổi thành màu vàng, vắt sữa khó gây viêm
vú.
- Sau khi hàng loạt mụn nước vỡ dần sẽ dẫn đến nhiễm trùng máu, nhiễm
trùng da, thú sốt cao, suy nhược dần.
2.1.4.2. Thể biến chứng
Những biến chứng xảy ra khi điều kiện vệ sinh, chăm sóc kém làm mụn vỡ dẫn
đến nhiễm trùng, chân bị long móng, thối móng, thối xương làm thú què. Vú thì bị viêm
tắt sữa. Các mụn khác vỡ sẽ gây nhiễm vi khuẩn kế phát, bại huyết.
Bệnh lỡ mồm long móng ghép với các bệnh ký sinh trùng hay vi khuẩn khác có
sẵn trong máu (tiêm mao trùng, lê dạng trùng...) có thể làm con vật mau chóng chết.
2.1.4.3. Thể ác tính
Trên bê nghé ngoài triệu chứng sốt cao, thú bị tiêu chảy và chết đột ngột trước khi
xuất hiện các mụn nước ở thượng bì do viêm ruột cấp tính, viêm phổi cấp hoặc viêm cơ
tim cấp tính.
2.1.5. ệnh tích
Chủ yếu ở đường tiêu hóa như miệng có các vết loét ở lưỡi, lỗ chân răng, hầu,
thực quản, dạ dày… Ở đường hô hấp gây viêm phế quản. Bên trong phủ tạng: tim bị viêm
cấp, van tim bị sùi hoặc loét, lách bị sưng đen, niêm mạc ruột non ruột già xuất huyết
điểm, long móng, rụng xương bàn chân. Khi khỏi bệnh thì ở các vết loét sẽ để lại sẹo.
3
(1) (2) (3)
(4) (5) (6)
Hình 1.1: Một số hình ảnh triệu chứng, bệnh tích FMD trên bò: (1) Miệng chảy nhiều
nước bọt, (2)(3) Vết loét ở lưỡi, (4) Vết loét ở móng (5) Vết loét ở móng bò, (6)) miệng
loét ở lưỡi và môi, nưới răng.
2.1.6. ng bệnh
- Khi phát hiện dịch phải khai báo ngay với các cơ quan thú y và chính quyền địa
phương, cách ly thú bệnh, tránh tiếp xúc với thú khỏe và các loài thú khác
4
- Phòng bệnh bằng vệ sinh là rất quan trọng, thường xuyên sát trùng chuồng trại,
dụng cụ chăn nuôi, bãi chăn thả, bằng các loại thuốc sát trùng của ANOVA như: NOVA-
MC.A30, NOVACIDE, NOVASEPT, NOVADINE, NOVAKON.
- Khi xảy ra bệnh phải xử lý thật kỹ toàn bộ chuồng trại, dụng cụ chăn nuôi bằng
các loại thuốc sát trùng, các gia súc mắc bệnh phải tích cực điều trị phụ nhiễm và tránh
lây lan bệnh, xác chết phải được xử lý theo các quy định của ngành thú y. Không được
phép bán chạy hoặc tự ý giết mổ bán thịt các gia súc mắc bệnh.
- Định kỳ tiêm phòng bệnh lỡ mồm long móng bằng vaccin (1 năm tiêm 1-2 lần
tùy theo vaccin). Vaccin dùng nên lựa chọn vaccin đa giá có 2 type O và A
- Lịch chủng ngừa: Chủng ngừa lần đầu vào lúc 2 tuần tuổi đối với bê nghé từ mẹ
chưa tiêm phòng và 50-70 ngày trên bê nghé từ mẹ đã được tiêm phòng bệnh. Sau 3-4
tuần thì tiêm lại lần 2 để nâng cao miễn dịch. Chủng ngừa định kỳ 6 tháng một lần.
2.1.7. Điều trị
Việc điều trị thường không mang kết quả tốt vì là nguồn bệnh sau này sẽ ảnh hưởng đến
các đàn heo nuôi kế tiếp. Có thể điều trị các triệu chứng và tăng sức đề kháng cho heo
như sau:
- Tiêu độc chuồng trại và xung quanh hàng ngày bằng các lọai thuốc sát trùng như
NOVADINE, NOVACIDE, NOVASEPT và liên tục cho đến 2 tuần sau khi gia súc được
điều trị khỏi bệnh.
- Điều trị các vết thương ở miệng: thoa bằng dung dịch NOVADINE hoặc dùng
chanh, khế thoa lên các mụn nước ở lưỡi, môi, nướu răng, mỗi ngày thoa 3-4 lần cho đến
khi hết mụn nước.
- Trong bệnh lỡ mồm long móng chủ yếu là điều trị triệu chứng và kết hợp sử
dụng kháng sinh để tránh nhiễm vi khuẩn kế phát. Sử dụng một trong các sản phẩm sau:
+ NOVA-NORCINE: tiêm bắp 1ml/20kg thể trọng, ngày 1 lần, 4-5 ngày
liên tục.
+ NOVA-GENTASONE 10%: tiêm bắp 1ml/20kg thể trọng, ngày 1 lần,
trong 3-4 ngày liên tục.
5
+ NOVASONE: tiêm bắp 1ml/12-15kg thể trọng, ngày 1 lần, trong 3-4 ngày
liên tục.
+ NOVA-TETRA LA: tiêm bắp 1ml/20kg thể trọng, 2 ngày tiêm 1 lần.
+Sử dụng NOVA PREDNI-C để kháng viêm hạ sốt tiêm bắp liều 1ml/25-
30kg thể trọng, dùng cho đến khi hết triệu chứng bệnh. Kết hợp sử dụng NOVA-
B.COMPLEX, NOVA-ATP COMPLEX, NOVASAL để tăng sức đề kháng bệnh và mau
hồi phục.
2.2.CẤU TRÚC GENOME CỦA VIRUS LỞ MỒM LONG MÓNG (FMDV)
Bộ gen của FMDV là ARN đơn chuỗi (+) gồm 8.5kb, tương ứng với 2,6.106 (dal)
có hệ số lắng 146S. Vỏ capsid gồm 4 loại protein vỏ: VP1,VP2, VP3, VP4, mỗi loại gồm
60 copy. VP1 có đặc tính sinh miễn dịch. Genome FMDV gồm 3 phần: Vùng 5’ không
dịch mã (5’ UTR- Untranslated Region) mang một đoạn poly C, vùng mã hóa (coding
region), vùng 3’ không dịch mã (3’UTR) và vùng không tương đồng (heteropolymeric)
và một đuôi poly(A) cần thiết cho sự sao chép virus.
6
Toàn bộ genome của FMDV mã hóa cho một protein đơn. Sau khi dịch mã,
protein này được phân cắt thành 4 sản phẩm sơ cấp: Amino terminal L protease, phân cắt
ở đầu cuối cacboxyl, P1-2A, tiền chất của protein vỏ; sẽ trải qua giai đoạn polyproteinsau
dịch mã với sự tham gia của các protease virus để tạo 1 promoter. 5 copy của promoter sẽ
sắp xếp thành một pentamer. 12 pentamer sau đó sẽ sắp xếp với RNA virus để tạo thành
một virion. 2B2C ,P3 được phân cắt để tạo thành protein sao chép hoặc protein không
cấu trúc: 3A, 3B, 3C, và 3D, polymerase RNA phụ thuộc RNA.
Việc phân cắt các polyprotein ban đầu đều có sự tham gia của các protease do
virus mã hóa, sự phân cắt này diễn ra cực kì nhanh chóng.
Việc chuẩn đoán bệnh FMD được thực hiện theo các phương pháp chuẩn hóa
được quy định bởi tổ chức dịch tễ thế giới OIE (Office International des Epizooties). Các
phương pháp chuẩn đoán bao gồm: Xác định tác nhân gây bệnh ( phân lập, ELISA, xác
định acid nhân virus..). Trong mục đích chuẩn đoán tác nhân gây bệnh, loại mẫu tốt nhất
là mẫu biểu mô tại vùng mụn nước chưa bị vỡ hoặc chỉ mới bị vỡ. Mẫu phải được bảo
quản cẩn thận trong dung dịch glycerol pha với dung dịch đệm photphat pH 7,2-7,6 và
kháng sinh; mẫu được giữ trong điều kiện lạnh để vận chuyển về phòng thí nghiệm, tốt
nhất là giữ đông lạnh ở -70oC
2.3.RT-PCR
RT - PCR là phản ứng sinh tổng hợp DNA trên khuôn mẫu RNA, do một DNA
polymerase là reverse transcriptase (RT enzyme) xúc tác.
Tổng hợp cDNA (complementary DNA) trên khuôn RNA gồm ba bước :
- Bước 1: Chiết xuất RNA tổng số, trong đó có RNA của virus.
- Bước 2: Tổng hợp sợi cDNA thứ nhất nhờ reverse transcriptase. Tùy thuộc vào
mục đích thí nghiệm, primer để tổng hợp sợi DNA đầu tiên có thể được lai chuyên
biệt với một gen đích hay có thể kết hợp với toàn RNA. Có ba loại primer có thể dùng
trong tổng hợp cDNA.
(1) Oligo (dT): kết hợp với đuôi poly A của mRNA của động vật hữu nhũ.
(2) Primer chuyên biệt với trình tự đã chọn trên RNA đích.
(3) Random hexanucleotide: có thể khởi đầu sự tổng hợp cDNA ở nhiều điểm trên
RNA khuôn mẫu tạo ra nhiều đoạn bản sao của toàn phân tử RNA. Chúng hữu
dụng khi RNA đích là quá dài hay chứa quá nhiều cấu trúc bậc hai đến nỗi sự
tổng hợp cDNA không bắt đầu hiệu quả bởi oligo (dT) hay primer chuyên biệt. Trong
hầu hết trường hợp, mục đích của những nhà nghiên cứu là tạo cDNA ban đầu dài và
chứa nhiều thành phần của phân tử bổ sung với trình tự RNA đích. Do đó primer chuyên
7
biệt là lựa chọn tốt nhất. Tiếp đến là oligo (dT) cũng tốt cho sự lựa chọn. Random
hexamer không chuyên biệt và tạo ra những phân tử cDNA dài, ngắn khác nhau được sử
dụng khi những phương pháp kia không hiệu quả.
- Nhân sợi cDNA thứ nhất lên nhiều bản bằng PCR. Giai đoạn này gồm có 3 bước như
sau:
+ Denature (biến tính): Chuyển dây đôi thành dây đơn
+ Annealing (bắt cặp): Primer gắn vào vị trí trên dây khuôn mẫu có mã đối
xứng với nó.
+ Extension (kéo dài): Kéo dài chuỗi mới nhờ enzyme polymerase.
Ba giai đoạn này lặp lại nhiều lần, để tạo nhiều sản phẩm khuếch đại. Ba giai
đoạn này xảy ra trong điều kiện nhiệt độ khác nhau (ví dụ: 94oC, 55oC, 72oC) với sự trợ
giúp của enzyme polymerase. Sự lặp lại theo chu kỳ thường xảy ra khoảng 30 lần để làm
tăng lượng sản phẩm. Độ dài của sản phẩm PCR tùy thuộc vào số đoạn và chiều dài của
primer trong phản ứng, điều kiện chất buffer, nhiệt độ bắt cặp của primer.
Reverse transcriptase, là một DNA polymerase phụ thuộc vào RNA làm
khuôn mẫu. Hiện có hai loại Reverse transcriptase được giới thiệu trên thị trường :
- AMV (Avian myeloblastosis virus) Reverse Transcriptase.
- Mo - MLV Reverse Transcriptase (Moloney murine leukemia virus).
Mo - MLV Reverse Transcriptase đ ợc dùng nhiều hơn đối với thực vật. Để tổng
hợp DNA cần một đoạn primer gắn trên mẫu RNA làm chỗ khởi động.
Chú ý, khi làm việc với RNA cần cẩn thận để tạo môi trường không có
ribonuclease. Ribonuclease hay RNAse có thể ở mọi nơi. RNAse rất bền và khó bị bất
hoạt. Cần duy trì môi trường không có RNAse từ giai đoạn tinh sạch RNA cho đến suốt
quá trình phân tích.
2.4. PHƯƠNG PHÁP GIẢI TRÌNH TỰ
Hiện nay, với trình độ khoa học ngày càng phát triển, phương pháp xác định trình
tự nucleotide ra đời đóng vai trò quan trọng trong nghiên cứu cũng như ứng dụng trong
thực tế. Hai phương pháp xác định trình tự chính là phương pháp hoá học của Maxam
Gilbert (1977) và phương pháp enzyme học của Sanger và cộng sự (1977). Dù rất khác
nhau về nguyên tắc, hai phương pháp này có một số điểm chung: hình thành một tập hợp
nhiều oligonucleotide có chiều dài khác nhau, mỗi oligonucleotide có xác suất xuất
hiện bằng nhau trong phản ứng. Các trình tự này sau đó được phân tách dựa vào kích
thước bằng phương pháp điện di trên gel polyacrylamide có khả năng phân tách hai
trình tự chỉ cách nhau 1 nucleotide. Kết quả được đọc trên bảng phóng xạ tự ghi hoặc
nhờ một máy dò tự động.
8
2.4.1. Nguyên tắc hóa học : Phương pháp Maxam và Gilbert
Phương pháp này dựa vào sự thủy giải đặc trong phân tử DNA cần xác định
trình tự bằng phương pháp hoá học.
Trước hết các phân tử DNA đ ợc đánh dấu bằng 32 chia thành 5 phân đoạn, mỗi
phân đoạn chịu một xử lý hoá học chuyên biệt có khả năng làm biến đổi đặc trong
một loại nucleotide và sau đó cắt phân tử DNA ngay nucleotide ấy. Năm nhóm
nucleotide bị tác động là: G, A, C, G+A, T+C. Kết quả của các xử lý hoá học là sự hình
thành năm tập hợp nucleotide, các oligonucleotide trong một tập hợp có kích thước
khác nhau nhưng đều chấm dứt tại cùng một loại nucleotide. Cuối cùng năm
phân đoạn trên được đem phân tách trên gel polyacrylamide. Vị trí của các
oligonucleotide trên gel tương ứng với kích thước của chúng và đuợc phát hiện nhờ
đầu có đánh dấu phóng xạ. Kết quả được đọc trên bảng phóng xạ tự ghi.
2.4.2. Phương pháp enzyme học thông qua việc sử dụng các
dideoxynucleotide của Sanger.
Phương pháp này dựa vào sự tổng hợp nhờ enzyme DNA polymerase mạch bổ
sung cho trình tự DNA mạch đơn cần xác định. Đặc trưng của phương pháp là ngoài bốn
loại nucleotide thông thường còn sử dụng thêm bốn loại dideoxynucleotide là
những deoxynucleotide trong đó nhóm 3’OH được thay thế bằng H. Điều này khiến các
dideoxynucleotide không còn khả năng hình thành các nối phosphodiester và do đó sẽ
làm ngừng quá trình tổng hợp.
Trình tự DNA cần xác định cần phải được tạo dòng trong một vector mạch đơn
(phage M13). DNA polymerase sử dụng có thể là đoạn Klenow của DNA polymerase I,
Taq polymerase hay Sequanase. Sự tổng hợp mạch mới bắt đầu bằng từ một mồi bắt cặp
với một trình tự chuyên biệt trên phage M13, với sự hiện diện của bốn loại
nucleotide trong đó một loại được đánh dấu đồng vị phóng xạ (35S). Phản ứng tổng hợp
được tiến hành trong bốn phân đoạn riêng. Người ta lần lượt cho vào mỗi phân đoạn
một trong bốn loại dideoxynucleotide với hàm lượng rất nhỏ. Do hàm lượng thấp nên
thỉnh thoảng mới có một dideoxynucleotide được sử dụng vào phản ứng tổng hợp một
olidonucleotide và lập tức sự tổng hợp oligonucleotide đó ngừng lại. Tính xác suất thì
trong mỗi phân đoạn sẽ có mặt tất cả các cỡ oligonucleotide ứng với tất cả các nucleotide
cùng loại hiện diện trên trình tự DNA. Ví dụ: nếu trình tự DNA cần xác định là
AATCGATAGGCTTGCATG thì trong phân đoạn có mặt dideoxynucleotide ddC sẽ có
sự tổng hợp các oligonucleotide sau:
AATC
AATCGATAGGC
AATCGATAGGCTTGC
Sau đó bốn phản ứng tổng hợp sẽ được đem phân tách trên gel polyacrylamide và
kết quả được đọc trên bản phóng xạ tự ghi.
9
2.4.3. Giải trình tự bằng máy đọc tự động
Hiện nay, đã có những phương pháp cải biên từ phương pháp của Sanger như
phương pháp giải trình tự bằng máy tự động qua cloning và trực tiếp từ sản
phẩm PCR. Ở đây, chúng tôi tiến hành giải trình tự trực tiếp từ sản phẩm PCR bằng máy
đọc trình tự tự động ABI PRISM 3100 của công ty AB (Applied Bioscience). Máy
hoạt động dựa trên nguyên tắc của Sanger nhưng có một số cải biên. Trong kỹ thuật này
người ta không đánh dấu bằng các đồng vị phóng xạ mà bằng hoá chất – các
fluochrome. Mỗi loại dideoxynucleotide được đánh dấu bằng một fluochrome có màu
khác nhau. Như vậy, tất cả các oligonucleotide cùng chấm dứt tại một loại
dideoxynucleotide sẽ có cùng một màu. Sau khi điện di trên gel polyacrlamide, kết
quả sẽ được đọc qua một hệ thống vi tính.
Trước hết, đoạn DNA cần xác định trình tự được khuếch đại bằng phương pháp
PCR. Sau đó hai mạch của phân tử DNA đựợc tách rời nhau. Mỗi mạch được bắt cặp bởi
một mồi (có thể là mồi dùng cho phản ứng PCR hay một mồi nằm bên trong đoạn DNA).
Phản ứng tổng hợp xảy ra tương tự như trong các phương pháp enzyme học sử dụng
dideoxynucleotide. Phương pháp đọc trình tự trực tiếp từ sản phẩm PCR chỉ sử dụng khi
vùng cần xác định trình tự đã biết tr ớc và ứng dụng chủ yếu là nhằm phát hiện nhanh
một đột biến điểm.
PHẦN III:VẬT LIỆU VÀ PHƯƠNG PHÁP
3.1.Vật liệu
Trong nghiên cứu này, chúng tôi nghiên cứu trên 82 chủng virus type A trong đó
có 80 chủng được phân lập và phục hồi từ những ổ dịch khác nhau trên 15 bang của Ấn
Độ từ 1984-2000 và 2 chủng đã có vaccine IND/490/97 và A10-Indian Vaccine Strain
(A10-IVS) . Những chủng này vẫn được lưu giữ tại kho dữ liệu quốc gia của Ấn Độ về
FMDV
3.2.Phương pháp
Quy trình chung cho quá trình xây dựng cây sinh dòng của 82 chủng FMDV
10
3.2.1. Nuôi virus-và thu hoạch tế bào
82 chủng virus được cấy chuyền 3-5 lần trong môi trường tế bào một lớp BHK-
21(Baby hamster kidney cell line ) . Ta tiến hành thu các tế bào nhiễm bệnh nổi lên trên
mặt môi trường đem cất ở 70oC trước khi sử dụng
3.2.2.Li trích RNA tổng số
RNA tổng số được ly trích bằng bộ kít li trích RNA (Qiagen)
3.2.3. Chạy RT-PCR và giải trình tự
Phản ứng reverse transcriptase (RT) tạo cDNA
- Thành phần phản ứng RT:
• Primer (NK61,5’GACATGTCCTCCTGCATCTG-3’) 20pmol
• AMV Reverse Transcriptase 1 µl
• RNA tổng số 10 µl
• Hỗn hợp phản ứng cuối cùng 20 µl
Hỗn hợp phản ứng được ủ tại 48oC trong 1h để tổng hợp cDNA. Tiếp theo ủ tại 95oC
trong 5 phút để bất hoạt enzym.
Sau đó chạy phản ứng PCR khuếch đại các cDNA vừa mới tạo thành từ phản ứng
Reverse Transcriptase
Phản ứng khuếch đại PCR của những cDNA này được tiến hành sử dụng Hotstar
PCR kit(Qiagen) và 20 pmol của mỗi primer( NK61 và
11
pA-1C562,5’TACCAAATTACACACGGGAA) theo hướng dẫn được cung cấp. Phản
ứng được thực hiện theo chu trình nhiệt: chu kỳ đầu tiên biến tính tại 95oC trong 15 phút
theo sau bởi 35 chu kỳ theo chu trình: biến tính tại 94oC trong 1 phút, bắt cặp tại 55oC
trong 1 phút, kéo dài tại 72oC trong 1.5 phút. Chu kì cuối cùng kéo dài tại 72oC trong 10
phút. Sau đó sản phẩm PCR đem điện gi và quan sát dưới tia UV.
Trước khi giải trình tự sản phẩm PCR được tinh sạch bằng QIAquick
kit(QIAGEN). Sản phẩm PCR sau khi được tinh sạch đem đi giải trình tự với fmol Cycle
Sequencing kit(promega) và primer Cy5 đã được đánh dấu (antisense 5’-
GAAGGGCCCAGGGTTGGACTC). Trong một vài trường hợp, một primer đánh dấu
được thêm vào (pA-1C612,TAGCGCCGGCAAAGACTTTGA) được sử dụng để hoàn
thành việc giải trình tự gen 1D. Việc giải trình tự được thực hiện trên hệ thống phân tích
ALFexpress II DNA (pharmacia)
3.2.4. Phân tích dữ liệu sau khi giải trình tự
Các trình tự phân tử được so sánh dựa trên phần mềm Clustal W sẵn có trong
chương trình OMIGATM (Oxford MolecularLtd,England) . Phân tích cây sinh dòng được
thực hiện bằng phần mềm PHYLIP version 3.5c . Trong quá trình phân tích khoảng cách
tiến hóa cũng được tính toán bằng phần mềm DNADIST. Khoảng cách nền được sử dụng
để tạo cây họ hàng bằng phần mềm NEIGHBOR. Cây cuối cùng được vẽ bằng TreeView
1.5.2. Những cây địa hình được đánh giá bằng việc phân tích mối quan hệ từ 100 bản sao
của dữ liệu gốc được thiết lập trong chương trình BOOTSTRAP, DNADIST,
NEIGHBOUR và CONSENSE . O2/Brescia/1947 được kể đến trong phân tích như một
loài xa lạ.Một sự so sánh độc lập khác của trình tự nucleotide và cấu trúc phía sau của
cây UPGMA được thực hiện bằng chương trình “EpiSeq”( được viết bởi N.J. Knowles,
Pirbright Laboratory,UK). Các phân tích được thực hiện trên chương trình DNASTAR
(DNASTAR, Inc, Hoa Kỳ). Các trình tự được lấy từ GenBank / EMBL hoặc đã được
công bố trước đó để so sánh (nhập số accession hoặc số tham khảo trong dấu ngoặc đơn)
A10-Holland (M20715), A10-61 (X00429), A12-119b (J02187), IND 17/77 (AF
204108),A5/Spain/86 (M72587), A5/Tubingen , A24/Pirbright , Iran/4/98 (trình tự cung
cấp bởi Drs. N. J. Knowles and R. P. Kitching, IAH, Pirbright), A22/550 Azerbaijan/65
(A22/Azerbaijan/65; X74812), A24/Cruzeiro/Brazil/55 (A24/Brazil/55; K03340),
A27/Cundinmarca/Colombia/76 (A27/Colombia/76; K03341), Argentina/79 (K03345),
81/Castellanos/Argentina/87 (Argentina/87; U62255), Madrid (E)/1983 (Madrid/83;
M16084), Modena (I)/1984 (Modena/84; M16082), Morocco (MA)/1983 (Morocco/83;
M16090), Venceslau/Brazil/76 (Brazil/76; K03344), 4 chủng Trung Quốc (NM/EL/60,
NM/ XZ/64, XJ/KT/58, GS/LX/62; AJ131663, AJ131664, AJ131665, AJ131666),
A22/Iraq 24/64 , Albania/1996 (Albania/96), Iran/1987, SaudiArabia/1992
(SAU/92),A22/Thailand/1993 (Thailand/93), Thailand/1996 (Thailand/96),
Bilbao/Spain/1973 (Spain/73), A1/Bavaria/ 1946 (A1/Bavaria/46), A7(5)/Greece/1954
(A7/Greece/54) , BAN/2/87, Iran/2/97, Iran/ 17/97, MAL/10/97, Turkey/1992
(Turkey/92), Turkey/96 , A5/Westerwald and A32/Venezuela/70 .
12
PHẦN IV:KẾT QUẢ
4.1. Sự phân nhóm kiểu gen của virus
Một phần của chuỗi trình tự không thể cung cấp một cách đầy đủ những thông tin
trong cây phát sinh loài cho sự phân loại có ý nghĩa của virus. Nhiều nhà nghiên cứu đã
đề xuất rằng phải biết ít nhất trình tự 250 nu, nếu không biết trình tự đầy đủ của gen 1D,
để suy xét trong việc phân loại dịch tễ phân tử của FMDV. Theo những đề xuất trên,
chúng tôi đã phân tích hoàn toàn trình tự gen 1D của 83 chủng virus phân lậ từ Ấn Độ
bao gồm cả 3 chủng vacxin (IND 17/77, IND 490/97 and A10-IVS) và 37 trình tự sẵn có
trong những dữ kiệu đã được công bố trước đó để xác định sự khác nhau phổ biến giữa
những kiểu genotype. Ở đây chúng tôi đã xác định các kiểu gen khi một nhóm được phân
lập với độ biến động ít hơn 15%. Những tiêu chí tương tự đã được sử dụng bởi các tác giả
khác để phân loại kiểu gen FMDV sử dụng một phần trình tự. Trong cây UPGMA (hình
1), được xây dựng từ trình tự gen 1D, các chủng FMDV được phân thành 10 kiểu gen
chính(đánh số thự tự theo thời gian phân lập)
13
Hình 1: Cây UPGMA xây dựng từ trình tự gen 1D, biểu thị mối quan hệ di truyền của các chủng
FMDV serotype A. Genotype (kiểu gen) được đánh dấu từ I-X ( theo thứ tự thời gian phân lập)
được hiển thị trong các nhánh
14
4.2. Các Genotype trong cây sinh dòng
4.2.1.notype I
Kiểu gen này đại diện cho 16 chủng được phân lập trong khoảng 5 thập kỉ (1942-
1986), bao gồm các virus từ Columbia,Greece, India, Italy,Morocco,Netherlands và
Spain. Trong nghiên cứu này, chúng tôi lưu ý đến những kiểu gen lâu đời nhất của
FMDV serotype A. 4 chủng được phân lập bao gồm cả A10-IVS được đưa vào nhóm
này. Độ biến động giữa 2 chủng A10-IVS và A10-Holland là khoảng 1,3%. Những bằng
chứng này cho thấy 3 chủng phân lập thì có mối quan hệ gần với A10-IVS( độ biến
động 1.8-2.2%) để chỉ ra rằng có sự biến đổi chủng virus từ các chủng vacxin là có thể
xảy ra.. Những virus thuộc genotype này được phân lập ở Ấn Độ từ 1984-1986 và không
tìm thấy chúng nữa sau năm 1986. Armstrong và các cộng sự đã tường thuật mối quan hệ
gần gũi cuộc các dòng virus Ấn Độ trong quá trình phục hồi suốt năm 1986 với A10-
Holland/42 bằng việc sử dụng kháng thể đơn dòng
4.2.2.notype II
Kiểu gen II có chứa nhugn74 chủng từ Argentina, Brazil, United Kingdom và
Venezuela được phân lập trong thời gian 1954-1979
4.2.3.notype III
Kiểu gen này đại diện cho bốn chủng trên lợn được phục hồi từ Trung Quốc suốt
thời gian 1958-1964. Sự biến động giữa chúng từ 2,4-9,5%. Kiểu gen này đại diện cho
những chủng được phân lập từ vùng mà được báo cáo là có virus type O
4.2.4.notype IV
Các chủng từ Bangladesh, India, Iraq và USSR được phân lập từ 1964-1989 được
gộp lại trong genotype này chỉ sự phổ biến và sự lan trải trên một vùng địa lý rộng lớn .
Chủng A22 Irag 24/64, được phân lập năm 1964, là chủng lâu đời nhất được phân lập
trong nhóm này với sự biến động 15,1-16,4% với những chủng Indian trong cùng
genotype. Điều quan trọng cần lưu ý là các chủng này được phân lập trước năm 1990 và
dường như không còn tồn tại ở Ấn Độ.
4.2.5. notype V
Những chủng thuộc kểu gen này đến từ Châu Âu (Spain/73) và Nam Mỹ
(Argentina/87) và được phân lập trong suốt 15 năm
4.2.6.notype VI
Kiểu gen này gồm 25 chủng được phân lập bao gồm 1 chủng vacxin IND 490/97
được phân lập năm 1982 và hầu hết là từ gia súc, có hai chủng phân lập từ trâu và 1
chủng phân lập từ bò. Sự biến động giữa các chủng trong nhóm khoảng từ 0,2-12,8 % .
Chủng vacxin IND 490/97 được ước tính với sự biến động 6,8-12,1% nu so với những
chủng còn lại trong nhóm này.
15
4.2.7.notype VII
Kiểu gen VII chứa 49 chủng bao gồm một chủng phân lập từ Albania
(Albania/96), tỷ lệ biến động 2.8-14,7% so với những chủng phân lập ở Ấn Độ.Hầu hết
những chủng được phân lập trên gia súc và 2 chủng được phân lập trên trâu (IND
39/2000 và IND 81/2000). IND 21/90 phân lập vào năm 1989 từ Assam là chủng lâu đời
nhất trong genotype này
4.2.8.notype VIII
Các virus thuộc kiểu gen này được tìm thấy ở Iran, SaudiArabia, và Thổ Nhĩ Kì.
Hai chủng được phân lập gần đây cho thấy tỷ lệ biến động xấp xỉ 1,8% trái lại Iran/87 là
chủng được phân lập lâu nhất trong nhóm này cho thấy tỷ lệ biến động tối đa 8,8-12,4 %
so với những chủng còn lại trong nhóm này
4.2.9.notype IX
Kiểu gen này bao gồm 1 chủng từ Malaysia và 2 chủng có quan hệ gần nhau ( độ
tin cậy 96,7%) được phân lập từ năm 1993 đấn 1997. Sự khác biệt giửa các nu có thể
thấy trong nhóm
4.2.10. Genotype X
Kiểu gen này chỉ tìm thấy ở Iran, bao gồm 3 chủng được phân lập trong thời gian
2 năm (1997 và 1998). Tỷ lệ biến động tối đa khoảng 1,8% được so sánh giữa Iran/4/98
và Iran/17/97. Chúng biến động gần 19% so với những chủng phân lập khác cũng ở Iran
trong Genotype VIII. Kiểu gen này chia một nhánh với kiểu gen VII, cho thấy sự hiện
diện của cùng một tổ tiên chung giữa 2 kiểu gen này.
4.3. PHÂN TÍCH SỰ PHÁT SINH LOÀI TRÊN GEN 1D
Để phân tích mối quan hệ tiến hóa giữa những chủng FMDV phân lập được, một
cây quan hệ đã được xây dựng dựa trên trình tự gen 1D (hình 2). Trong cây này, những
dòng Châu Âu và Nam Mỹ ( bao gồm dòng Indian A10) tạo thành một cụm so với các
dòng Châu Á. Đây là một điều thú vị , hầu hết các chủng trong mỗi cụm thì được chia
thành các dòng khác nhau theo kiểu tương tự như trong cây UPGMA, và được phân về
địa lý. Mặc dù các chủng được phân lập trong kiểu gen IV hình thành một nhóm phân
biệt trong cây UPGMA. Chúng không tạo thành một cụm đơn trong cây quan hệ và được
rải rác hầu hết ở các chủng khác trong cây quan hệ. Ý nghĩa của mỗi dòng được hỗ trợ
bởi giá trị bootstrap trên 50% (trong số 100 bản sao). Các cụm Châu Âu và Nam Mỹ
được chia thành 3 dòng với tỷ lệ bootstrap tin cậy khoảng 54-69%. Trong cụm Châu Á,
những virus được phân lập gần đây từ Ấn Độ hình thành 2 dòng riêng biệt (kiểu gen VII
và VII) với giá trị bootstrap khoảng 57-99% và có vị trí xa nhau trong cây quan hệ. Trong
cây quan hệ, chủng Ấn Độ IND 2/93, được nhóm chung với kiểu gen Iran (kiểu gen
X).Mặc dù việc hình thành nhóm được chứng minh bởi giá trị bootstrap thấp (31%)
nhưng cũng không thể loại trừ khả năng IND 2/93 có thể là tổ tiên của dòng Iran. Điều
này là có thể khi so sánh những trình tự amino acid của nhóm này với dòng Ấn Độ.
16
Những kiểu gen châu Á còn lại( III, VIII và IX) hình thành những dòng xác định trong
cây với giá trị bootstrap trên 99%
4.4. SO SÁNH TRÌNH TỰ AMINO ACID CỦA VÙNG VP1
Để phân tích các cơ sở phân tử cho thấy sự biến động di truyền trong những chủng
phân lập ở Ấn Độ, trình tự amino acid của gen 1D cũng được so sánh (hình 3). Một số tài
liêu cho thấy rằng vị trí kháng nguyên trong FMDV serotype A tại vị trí vòng lặp G-H (từ
138 đến 154), và gần các vị trí 83,168 và 173 của protein VP1. Trong vòng lặp G-H,
RGD tripeptide tại vị trí VP1 144-146 và 2 acid amim Leucine(L) tại vị trí 147 và 150 là
được bảo toàn một cách đầy đủ trên các chủng đã được phân lập tại Ấn Độ . Tuy nhiên,sự
thay thế thường xuyên các amino acid cũng được quan sát trên những vùng lân cận( VP1
139,140,141,142,149,153). Đây là khu vực quan trọng vì có thể tìm được miễn dịch trội
của FMDV A22.. Vòng lặp B-C (VP1 40-60) chứa một vị trí kháng nguyên quan trọng
của FMDV serotype O và C, trái lại không có báo cáo nào về kháng nguyên thuộc vùng
này trên FMDV seotype A. Từ những báo cáo so sánh, vị trí VP1 42-48 thí quan trọng
trong việc xác định kháng nguyên của những chủng virus có trình tự amino acid thay đổi
một cách thường xuyên. Trong genotype VI và IV( ngoại trừ chủng được phân lập trên
voi, IND 61/88), tất cả những chủng được phân lập có trình tự RRGD tại ví trí VP1 143-
146, trong khi hầu hết các chủng phân lập trong genotype VII (ngoại trừ IND 2/93, IND
96/96 và IND 104/2000),có TRGD tại cùng một vị trí. Một vị trí kháng nguyên nhỏ đã
được xác định rõ đặc điểm tại VP1 169 (tương ứng với 168 ở FMDV A22) trên virus
A10-Holland. Trong genotype IV và VI (ngoài trừ IND 170/88) hầu hết các chủng phân
lập đều có Arginine(R) , trong khi đó ở genotype VII (ngoại trừ IND 21/90 và IND
2/93), Lysine (K) được tìm thấy tại vị trí VP1 168. Vị trí VP1 173 cũng có vai trò quan
trọng trong việc xác định điểm kháng nguyên, và một số amino acid thay thế được tìm
thấy trên những chủng được phân lập, Hai aminoacid thay thế tại VP1 109 (K→R) và
213 (L→Q) thì đặc trưng cho một chùng phân lập trên voi (IND 61/88) trong genotype
IV. Có 24 loại amino acid khac nhau trong đó có 15 loại nằm gần hay ngay tại vùng
kháng nguyên gữa 2 chủng vacxin được sử dụng gần đâylà IND 490/97 và IND 17/77.
Việc thay thế các amino acid được xem xét trong vùng kháng nguyên của những chủng
khác nhau được mong đợi là sẽ ảnh hưởng tới tính kháng nguyên của protein VP1. Trong
genotype I, cả 3 chủng có mối quan hệ thân thuộc với chủng vacxin A10-IVS thì khác
nhau tối đa 6 amino acid. Trong tất cả các chủng đã phân lập, bao gồm A10-IVS thiếu
mất 1 codon tại vị trí VP1 142 khi so sánh vói A10-Holland
17
Hình 2: Cây sinh dòng của FMDV serotype A suy ra bằng phương pháp neighbor-joining. Giá trị
bootstrap tin cậy của những dòng chính đã được chỉ định (giá trị trên 50% trong số 100 bản sao).
Những kí hiệu genotype ,được xác định trong cây UPGMA (hình 1) đã được chỉ định. Chiều dài của
nhánh đã giảm đến 50% để tiết kiệm không gian. Tỷ lệ của các thanh đại diện cho khoảng cách di
truyền
18
PHẦN V : KẾT LUẬN
5.1.KẾT LUẬN
Ở đây chúng tôi chỉ tiến hành phân tích di truyền hoàn toàn trình tự vùng trình
tự vùng 1D(639 nu) của 82 chủng FMDV serotype A được phân lập , bao gồm 3
chủng vaccine (A10-IVS, IND 17/77 và IND 490/97) được khôi phục ở Ấn Độ trong
thời gian 1977- 2000. Để nghiên cứu những biến đổi phân tử có liên quan đến đa dạng
di truyền trên một số chủng phân lập, chúng tôi đã giải trình tự và so sánh hoàn toàn gen
1D và suy ra trình tự amino acid. Tiến hành xây dựng cây sinh dòng của 82 chủng virus
serotype A.
Những báo cáo so sánh đã chỉ ra rằng những thay thế tại các vị trí 83, 139, 140,
141,149,153 và 173 trên VP1 và những phần còn lại được xác định là quan trọng bởi
những đột biến trung hòa của FMDV serotype A.Những kết quả được miêu tả trong bài
báo cáo này chỉ ra sự liên quan của vòng lặp B-C VP1 trên các kháng nguyên của FMDV
serotype A. Từ những vùng này phần quan trọng của kháng nguyên, những thay thế tại
những vị trí này trên protein VP1 được tin rằng có vai trò giúp đỡ virus thoát khỏi những
miễn dịch xuất hiện lúc đầu trên thú
Những chủng FMDV serotype A từ các phần khác nhau trên trên thế giới có thể
được chia ra làm thành 10 genotype phân biệt trong cây UPGMA, mỗi nhánh đại diện
cho một vùng địa lí. Những genotype này,ngoại trừ genotype IV, hình thành từ những
nhánh khác nhau trong cây quan hệ với độ tin cậy bootstrap cao. Các chủng trong
genotype IV thì trộn lẫn với genotype khác trong cây.
5.2.ĐỀ NGHỊ
Tiếp tục tiến hành phân tích các chủng FMDV serotype A , xây dựng cây sinh
dòng của các chủng FMDV serotype A được phân lập từ năm 2000 đến nay.
Tiến hành phân tích xây dựng cây sinh dòng FMDV các serotype còn lại, đặc biệt
là FMDV serotype O và Asia-1 là những serotype phổ biến ở Việt Nam
19